18.2.08

El código de Venter


Hace unos días se anunció que Craig Venter y su equipo habían sintetizado el primer genoma artificial de la historia (más información)

Los creadores del primer genoma sintético de una bacteria incluyeron mensajes ocultos en la secuencia de su ADN (Fuente: Público.es)

Los mensajes ocultos resultaron ser los nombres de los autores del primer genoma sintético y un anuncio del Instituto en el que se desarrolló dicho genoma:

CRAIGVENTER,VENTERINSTITVTE, HAMSMITH, CINDIANDCLYDE, GLASSANDCLYDE

El ADN se traduce en ARN y este se transcribe en una secuencia de aminoácidos según un código bien conocido (código genético). Los mensajes se redactaban utilizando las letras que identificaban a los aminoácidos que codificaba, en última instancia, una secuencia de ADN concreta. Los aminoácidos tradicionalmente se nombran con tres letras (Met, Ser, ...) pero también se puede hacer utilizando una sola letra (más información).

Como sólo hay 20 aminoácidos, no están todas las letras del abecedario, así pues nos vemos obligados a hacer algunas trampas para poder escribir lo que queramos, por ejemplo, la "U", que no corresponde a ningún aminoácido, se puede sustituir por "V"

Algunos divulgadores de la talla de Carl Zimmerman han propuesto algunos juegos al respecto.

Al nivel que nos ocupa, puede ser una actividad de aula atractiva; similar a la que propone Mateo Peña del IES Peñalve - Palabras y frases creadas con los símbolos de los elementos (Rev. Eureka Enseñ. Divul. Cienc. 2007, 4(3) pp 557-559)

¿Cuál sería la secuencia de nucleótidos que codifica el siguiente mensaje: IES Politècnic?

1.- I= Isoleucina (Iso), E= Ac. Glutámico (Glu), S= Serina (Ser) , P= Prolina (Pro), O= Q= Glutamina (Gln), L= Leucina (Leu), I= Isoleucina (Iso), T= Treonina (Thr), E= Ac. Glutámico (Glu), C= Cisteína (Cys), N= Asparagina (Asn), I= Isoleucina (Iso), C= Cisteína (Cys)

2.- La secuencia de aminoácidos sería:

Iso-Glu-Ser-Pro-Gln-Leu-Iso-Thr-Glu-Cys-Asn-Iso-Cys

3.- Una molécula de ARN que codifica esta secuencia es:

AUU- GAA-UCU-CCU-CAA-CUU-AUU-ACU- GAA-UGU-AAU-AUU-UGU

para complicarlo un poco más:

AUUGAAUCUCCUCAACUUAUUACUGAAUGUAAUAUUUGU

3.- La molécula de ADN que codificaría este ARN sería la que sigue:

TAACTTAGAGGAGTTGAATAATGACTTACATTATAAACA

Salvo error, esta sería la secuencia de nucleótidos que deberíamos incluir en el ADN de un organismo para que sintetizara un proteína cuya secuencia de aminoácidos, contuviera el mensaje "IES Pqlitecnic" utilizando las letras que describen a los aminoácidos.

La secuencia de aminoácidos que se identifica por las letras que conforman mi nombre de pila, la codificaría la siguiente secuencia de ADN

AGACTTTCTCCTTAAGTT


¿Qué secuencia codifica tu nombre de pila?
_______________________________

Supongo que esto dará para muchas "tonterías":

1.- Una propuesta para la Semana de las Ciencias del centro: "Mensajes en el código genético"

En diferentes lugares del centro se pueden colgar en la pared secuencias de ADN impresas.

Cada secuencia oculta una palabra que los alumnos deberán identificar. Todas las palabras componen una frase que hay que completar (la frase secreta)

Los alumnos/as interesados en participar deberán inscribirse en el juego y recoger en Vicedirección las normas del mismo y el material necesario:
  • una breve descripción de proceso de transcripción y traducción del mensaje genético (apto para todos los públicos)
  • una tabla con las equivalencias entre nucleótidos,
  • una tabla con el código genético
  • una tabla con las letras que identifican a cada aminoácido y los huecos que hay que completar para averiguar la frase secreta.
2.- .....

3 comentarios:

Rafa Mollà dijo...

Si que pot ser interessant de cara a les Jornades.

Nacho dijo...

Hay quien también ha traducido el código genético pero a notas musicales creando la "música molecular"... también curioso. ¿cada ser vivo tenemos nuestra banda sonora original?

http://renaser.cl/articulos/ciencia/planta_melodia.html
http://en.wikipedia.org/wiki/Linda_Long

José L. Castillo dijo...

¡¡¡Vaya derroche de creatividad!!!

Felicidades. De las de verdad, de las que se dan con la boca abierta y su puntito de envidia.

Un saludo.